-
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Cape Ferguson...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Log of observations of seals, penguins, skuas, petrels, and whales at Davis, 1957
This file contains a log of biological observations made in the Davis region during 1957. It includes information on Elephant Seals, Leopard Seals, Crabeater Seals, Adelie... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Cape Ferguson...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Solander Trip...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Sea Ice Observations from the Nathaniel B Palmer 95-5b
These data describe pack ice characteristics in the Antarctic sea ice zone. These data are in the ASPeCt format. National program: United States Vessel: Nathaniel B. Palmer... -
Amery Ice Shelf - hot water drill borehole, 2005-06 - AM04 drilling parameters data
AM04 borehole drilled January 2006. Data collected in series of files over a period of 4 days during production of borehole. Consult Readme file for detail of data files and... -
Zooplankton abundance based on RMT1 net during SIPEX winter-spring transition
Zooplankton were collected during the winter-spring transition with an RMT8+1 net during the SIPEX voyage in 2007. Only the RMT1 data are presented here. The net was deployed on... -
Krill microbiome
Krill-associated bacterial communities characterised by high-throughput DNA sequencing of the 16S ribosomal RNA gene. The data is decribed in 'Clarke LJ, Suter L, King R,... -
Structure and geochemistry of Macquarie Island oceanic crust
Owing to the fact that the principal investigator died before data were able to be archived, the only available data are in the form of the referenced paper, which is available... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Cape Ferguson...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Contribution of dinoflagellates to Antarctic coastal zone carbon flux
Some scanning electron microscope images were taken of dinoflagellates sampled as part of this project. A catalogue of the images taken is provided as part of the download file... -
Resonance plays a secondary role in amplifying underwater vocalizations of...
The date are of the highest amplitudes across the frequency range of Weddell seal tonal trills (an underwater call made by males). Each column presents the results of a... -
Site occupancy by breeding Adelie penguins in East Antarctica
This dataset collates data on occupancy of geographic sites by breeding Adelie penguins across east Antarctica between 37 degrees E -160 degrees E from the 1950s to the present... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Solander Trip...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Cape Ferguson...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Diving Petrel (Pelecanoides) data tables from Heard Island - circa 1948-1960
These data tables were scanned by Fiona Gleadow. The data relate to diving petrels (Pelecanoides) from Heard Island, and generally appear to be measurements of body parts... -
Opal concentrations measured in sediment samples collected during the...
Sediment cores were collected from the East Antarctic margin, aboard the Australian Marine National Facility R/V Investigator from January 14th to March 5th 2017 (IN2017_V01;... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Cape Ferguson...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Aurora Australis Voyage 3 2012/13 Track and Underway Data
On every voyage of the Aurora Australis, approximately 50 onboard sensors collect data on average every 10 seconds. These data are known as the underway datasets. The type of... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,...