-
Aurora Australis Voyage 3 2012/13 Track and Underway Data
On every voyage of the Aurora Australis, approximately 50 onboard sensors collect data on average every 10 seconds. These data are known as the underway datasets. The type of... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Seabird strikes at Australian Antarctic Stations and on ships.
This indicator is no longer maintained, and is considered OBSOLETE. INDICATOR DEFINITION All known observations of seabird strikes are recorded upon observation at Australian... -
Historical fish data compiled from voyages and field surveys 1983-1995
This dataset comprises of an Access Database of compiled historical fish data from the following voyages and field surveys: Fish biological and stomach contents data - Casey... -
Aurora Australis Southern Ocean oceanographic data from geoscience cruise au9705
10 full depth CTD casts were taken in the vicinity of Mawson and Casey as part of the geoscience work on Aurora Australis cruise au9705, January to March 1997. A 12 bottle... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Solander Trip...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Physiological Tolerances of Some Antarctic Zooplanktons
Colonisation of Lake Fletcher, a hypersaline, meromictic lake in the Vestfold Hills, Antarctica, by the calanoid copepod Drepanopus bispinosus, the cyclopoid copepod Oncea... -
Aurora Australis Voyage 6 (FISHOG) 1991-92 Heard Island Chlorophyll a Data
This dataset contains the chlorophyll a data from Voyage 6 (FISHOG) 1991-92 of the Aurora Australis. The observations were taken from the Heard Island area in January and... -
Fluoride Concentration in Antarctic Marine Crustaceans
Metadata record for data from ASAC Project 587 See the link below for public details on this project. From the abstracts of some of the referenced papers: The concentration of... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Solander Trip...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Hydrographic survey HI333 by the RAN Australian Hydrographic Service at...
The RAN Australian Hydrographic Service conducted hydrographic survey HI333 at Corinthian Bay, Heard Island, March 2001. The survey dataset, which includes the Report of Survey,... -
Experimental studies into growth and ageing of krill 2002-2012
Metadata record for data from AAS (ASAC) Project 2337. An excel spreadsheet is available for download from the URL given below. The spreadsheet contains three worksheets: a... -
Further investigations of the effects of the Nella Dan oil spill
Metadata record for data expected from ASAC Project 1003 Further investigations of the effects of the Nella Dan oil spill on intertidal benthic communities at Macquarie Island:... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Cape Ferguson...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Extract of data from the sea ice measurements database - 1985-2007
These data have been extracted from an Australian Antarctic Data Centre application, "Sea ice measurements database". The application has now been discontinued. The download... -
Images, video and reports from an opportunistic visit to Heard Island and...
In December 2008, the RSV Aurora Australis had an opportunity to visit Heard Island and McDonald Islands. A number of activities took place and included: An aerial survey (16th... -
Aurora Australis Voyage 3 2009/10 Track and Underway Data
On every voyage of the Aurora Australis, approximately 50 onboard sensors collect data on average every 10 seconds. These data are known as the underway datasets. The type of... -
IMOS Ships of Opportunity Underway Data from AIMS Vessel RV Solander Trip...
'Ships of Opportunity' (SOOP) is a facility of the Australian 'Integrated Marine Observing System' (IMOS) project. This data set was collected by the SOOP sub-facility 'Sensors... -
Impact of changes in sea ice extent on primary productivity in the Southern...
A times series of data was collected from coastal (land-fast) sea ice at Davis Station, Eastern Antarctica (68 degrees 34' 36" S, 77 degrees 58' 03" E; Figure 1) from November... -
Uptake of heavy metals from copper and lead spiked sediments by...
This data set describes the concentrations of copper, lead and iron in the calcareous tests of heart urchins that were exposed to spiked sediments for 60 days. Porewater is the...