-
Data accompanying: Crustose coralline algae display sensitivity to near...
Most research investigating how ocean warming and acidification will impact marine species has focused on visually dominant species, such as kelps and corals, while ignoring... -
DMS and DMSP Data from CTD and Minicosm experiments conducted during the...
Data Acquisition: Sampling was performed on seawater collected from CTDs and minicosm experiments. Sampling involved the collection of 250 mL of seawater from each Niskin bottle... -
AIMS Long-term Monitoring Program
The AIMS Long-term Monitoring Program (LTMP) is designed to detect changes in reef communities at a subregional scale. In this context, a subregion encompasses inshore, mid-... -
Sea Water Temperature Logger Data at Hamelin Pool, From 26 Apr 2012 To 29 May 2017
This data set was collected by one or more temperature loggers deployed around the site of Hamelin Pool. -
DNA-based identification of Crown-of-Thorns Starfish (Acanthaster cf....
The datasets summarises the results from a research project examining predation on Crown of Thorn starfish by coral reef fish. It includes all fish species caught during four... -
Secchi disk visibility dataset, Great Barrier Reef
Each collection station is denoted by latitude and longitude and sometimes by name of reef, and date.Secchi readings comprise vertical readings from the lagoon and from inshore... -
Sea Water Temperature Logger Data at Geoffrey Bay, Great Barrier Reef From...
This data set was collected by one or more temperature loggers deployed around the site of Geoffrey Bay. -
Role of Antarctic marine protists in trophodynamics and global change and...
Locations of sampling sites for ASAC project 40 on rotation 4 of the French polar supply ship L'Astrolabe in the 2010/2011 season. Samples were collected between February and... -
RSV Nuyina Voyage Data 2023-24 V5
Voyage 5 of the 2023/2024 season onboard RSV Nuyina was a commissioning voyage to test scientific instrumentation and systems on board to ensure they were working correctly. The... -
Aurora Australis Voyage 4 1993-94 Underway Data
This dataset contains the underway data from Voyage 4 1993-94 of the Aurora Australis. This was a non-marine science voyage, but NoQalms data types were logged at 20-second... -
ERIN Dual-processed Landsat TM tiles in Western Australia - Ravensthorpe tile
A Landsat TM image was cut using a NATMAP Geoscience Australia 1:250 000 scale map named Ravensthorpe (Map number SI51-5) and was saved in GeoTIFF format. The image was... -
Reproductive patterns of the intertidal limpet, Siphonaria diemenensis at...
A combination of surveys and experiments were used to assess the reproductive patterns of Siphonaria diemenensis in 2 zones on the rocky shore at Griffith Point, San Remo,... -
Investigator Strait CTD Survey January 1986
A total of 40 CTD stations were collected in Investigator Strait from the ship Wave Dancer (cruise IS03) on 19-20 January 1986, and analysed for water temperature, salinity and... -
Settlement tiles
Data from the EcoRRAP settlement tiles. Five PVC settlement tiles were deployed in 2021 at each EcoRRAP zone, as well as adjacent reef flat sites. The tiles remained in situ for... -
IMOS - SOOP Ocean Carbon Dioxide Data from RV Southern Surveyor voyage...
This data was collected in March and April 2010 by the IMOS Ship of Opportunity Underway CO2 Measurement research group on RV Southern Surveyor (IMOS platform code: VLHJ) voyage... -
Halftide Rock Automated Marine Weather And Oceanographic Station
This dataset contains meteorological and sea temperature data from the weather station which was originally located on Halftide Rock (-23.15, 150.933) and later moved to Square... -
Wanaea Baseline Study Report on the Benthic Invertebrate Survey of Wanaea...
Wanaea Baseline Study Report on the Benthic Invertebrate Survey of Wanaea Oil Field, 1993. -
Annual report on the scientific work undertaken at Davis Station in 1985
This is a scanned copy of the annual report on the scientific work undertaken at Davis Station in 1985. The report was written by J.B. Gallagher. Paraphrased from the... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
SAIMOS - Biological and Flow Cytometry data collected from CTD stations in...
Flow cytometry data was collected in December 2018, in waters off South Australia. The general purpose of the study is to be able to establish background knowledge on the...