-
Environmental DNA metabarcoding for monitoring metazoan biodiversity in...
Our aim was to compare water and sediment as sources of environmental DNA (eDNA) to better characterise Antarctic benthic communities and further develop practical approaches... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Krill microbiome
Krill-associated bacterial communities characterised by high-throughput DNA sequencing of the 16S ribosomal RNA gene. The data is decribed in 'Clarke LJ, Suter L, King R,... -
K-Axis eukaryote Operational Taxonomic Units (OTU) table and contextual data
Sampling Samples were collected on board the RSV Aurora Australis between 22 January and 17 February 2016. The cruise surveyed the region south of the Kerguelen Plateau... -
Molecular data for Davis 14/15 ocean acidification minicosm experiment metadata
Experimental Design A six-level, dose-response ocean acidification experiment was run on a natural microbial community from nearshore Antarctica, between 19th November and 7th... -
K-Axis mesopelagic fish DNA-based diet analysis
High-throughput DNA-sequencing data for mesopelagic fish stomach contents sampled during the Kerguelen Axis voyage (January-Februay 2016). Mesopelagic fish form an important...
1 - 6 of 6 results