-
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Survey of soft sediment assemblages around Casey Station (Winter grab...
Marine soft-sediment assemblages were sampled from shallow (5 - 35m) nearshore regions around Casey Station, Windmill Islands, East Antarctica in winter 1998, using a van-Veen... -
Quality control toolbox for EM-APEX data (Electromagnetic Autonomous...
The EM-APEX quality control (QC) toolbox provides a framework to quality control CTD and velocity data and calibrate velocity data collected from Electromagnetic Autonomous... -
antFOCE Hard Substrate Fauna data sets
Metadata record AAS_4127_antFOCE_HardSubstrateFauna contains all data sets relating to the fauna sampled from hard substrates during the antFOCE experiment, including... -
Aurora Australis Voyage 1 (THIRST) 1993-94 Demersal Fish Data
This dataset contains the data from Voyage 1 1993-94 of the Aurora Australis. The observations were taken from around Heard Island between August and September 1993. The data... -
Geographic variations in underwater male Weddell seal Trills suggest...
Adult Weddell seals (Leptonychotes weddellii) exhibit site fidelity to where they first breed but juveniles, and perhaps transient adult males, may disperse from their natal... -
Biology Year Report for Davis Station, 1982
Taken from the biology report for Davis Station, 1982, prepared by Mark Tucker. A hardcopy of the report and field books are available in the Australian Antarctic Division... -
Sea Ice Observations from the Akademic Fedorov (40th Russian Antarctic...
These data describe pack ice characteristics in the Antarctic sea ice zone. These data are in the ASPeCt format. National program: Russia Vessel: Akademic Fedorov Dates in ice:... -
Sea Ice Observations from the Akademic Fedorov (35th Russian Antarctic Expedition)
These data describe pack ice characteristics in the Antarctic sea ice zone. These data are in the ASPeCt format. National program: Russia Vessel: Akademic Fedorov Dates in ice:... -
Satellite tracking of emperor penguin (Aptenodytes forsteri) fledglings at...
As seabirds emperor penguins spent a large proportion of their lives at sea. For food they depend entirely on marine resources. Young penguins rarely return to their natal... -
The role of Antarctic marine protists in trophodynamics and global change...
Update - 2013-11-14 - data from the cruise now included in the download file. Two extra excel spreadsheets have been added to the download file - one is a summary file, and the... -
BROKE-West microbial concentrations - Voyage 3 of the Aurora Australis 2005/2006
This data set contains concentrations of phytoplankton, protozoa, total bacteria and metabolically active bacteria assessed by flow cytometry on transects 12, 1, 3, 5, 7, 9 and... -
Toxicity of single metals and metal mixtures to Antarctic Marine Copepods
This metadata record contains the results of two bioassays testing the response of Antarctic marine copepods to both individual and combined metals via 14 day toxicity tests.... -
Macquarie Island 1:500 000 Bathymetric Data Set
A database containing sounding data around Macquarie Island. Track line data for each data source is included. -
Phytoplankton Ecology in the Fjords of the Vestfold and Larsemann Hills
From the abstract of the referenced paper: Spring phytoplankton communities in the water column of Ellis Fjord are characterised by diatoms originating from the bottom sea-ice... -
Census of Antarctic Marine Life (CAML) Archive of Project Documentation -...
The Census of Antarctic Marine Life (CAML) Project Archive is a collection of scanned documents, maps, videos, and other related material that comprise the organisation and... -
Acoustic whale tracking log of the 2013 Antarctic Blue Whale Voyage to the...
During the 2013 Antarctic Blue Whale Voyage Acousticians noted all whale calls and other acoustic events that were detected during real-time monitoring in a Sonobuoy Event Log.... -
Important marine habitat off east Antarctica revealed by two decades of...
From the abstract of the referenced paper: Satellite telemetry data are a key source of animal distribution information for marine ecosystem management and conservation... -
Survey report 2003/04 summer season Australian Antarctic Division Author -...
Taken from sections of the report: Introduction This report describes aspects of the fieldwork completed for the Australian Antarctic Division (AAD) mapping program during the... -
Antarctic ice shelf disintegration triggered by sea ice loss and ocean swell
The data are from our Nature Article from June 2018: "Antarctic ice shelf disintegration triggered by sea ice loss and ocean swell". The abstract is: "Understanding the causes...