-
International circumpolar compilation of nutrient concentration data from...
This dataset is an international circumpolar compilation of currently available macronutrient concentration data from Antarctic land-fast sea ice cores collected at locations... -
A data collation for climate-cooling gas dimethylsulphide in Antarctic snow,...
The database is comprised of folders of measurements of dimethylsulfide (DMS) and dimethylsulfoniopropionate (DMSP) in ice, snow, slush, water and brine. Data were collated and... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Flight trajectories and velocity of all currently employed whale sampling...
This project aimed to take initial steps towards producing a physical representation of an ethically and legally sound drone-based system intended as a safer method to generate... -
Laboratory studies of the flow of ice
Metadata record for data from ASAC Project 8 See the link below for public details on this project. This project studies the fundamentals of how ice flows. The project is... -
Whole rock geochemistry – major elements - from selected basalts dredged...
XRF geochemical major and trace element data of whole rocks collected from submarine edifices in the southern Tasman Sea. Samples that did not show alteration were used for the... -
Diatom data from piston core PC06 and PC07 collected during voyage 1, 2017...
Diatom data from piston core PC06 and PC07 from research cruise IN2017_V01: These data were generated by Amy Leventer (aleventer@colgate.edu), Department of Earth and... -
Chemical contaminants in marine sediment at Casey station from 1997 to 2015
Description: This data set is a collection of chemical and physical parameters determined for sediment samples collected from the marine benthic environment in the vicinity of... -
The development of DNA markers to resolve uncertainties of seabird bycatch...
Please refer to the manuscript - The development of DNA markers to resolve uncertainties of seabird bycatch identification from longline fisheries in Australian waters.... -
DNA diet data collected from Adélie penguin and snow petrel scats at...
Adélie penguin and snow petrel scats were collected at Béchervaise Island (67°35’S, 62°49’E) in the austral summers 2014/2015, 2017/2018 and 2019/2020 and stored in 80% Ethanol.... -
Whole rock geochemistry – trace elements - from selected basalts dredged...
Solution ICP-MS trace elements analysis in CODES, School of Physical Sciences (Earth Sciences), University of Tasmania (modified after P.Robinson by E.Lounejeva, August 2017)...
1 - 11 of 11 results