-
RSV Nuyina Voyage Data 2023-24 V5
Voyage 5 of the 2023/2024 season onboard RSV Nuyina was a commissioning voyage to test scientific instrumentation and systems on board to ensure they were working correctly. The... -
Aurora Australis Voyage 4 1993-94 Underway Data
This dataset contains the underway data from Voyage 4 1993-94 of the Aurora Australis. This was a non-marine science voyage, but NoQalms data types were logged at 20-second... -
ERIN Dual-processed Landsat TM tiles in Western Australia - Ravensthorpe tile
A Landsat TM image was cut using a NATMAP Geoscience Australia 1:250 000 scale map named Ravensthorpe (Map number SI51-5) and was saved in GeoTIFF format. The image was... -
Reproductive patterns of the intertidal limpet, Siphonaria diemenensis at...
A combination of surveys and experiments were used to assess the reproductive patterns of Siphonaria diemenensis in 2 zones on the rocky shore at Griffith Point, San Remo,... -
Investigator Strait CTD Survey January 1986
A total of 40 CTD stations were collected in Investigator Strait from the ship Wave Dancer (cruise IS03) on 19-20 January 1986, and analysed for water temperature, salinity and... -
Settlement tiles
Data from the EcoRRAP settlement tiles. Five PVC settlement tiles were deployed in 2021 at each EcoRRAP zone, as well as adjacent reef flat sites. The tiles remained in situ for... -
Wanaea Baseline Study Report on the Benthic Invertebrate Survey of Wanaea...
Wanaea Baseline Study Report on the Benthic Invertebrate Survey of Wanaea Oil Field, 1993. -
Annual report on the scientific work undertaken at Davis Station in 1985
This is a scanned copy of the annual report on the scientific work undertaken at Davis Station in 1985. The report was written by J.B. Gallagher. Paraphrased from the... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
SAIMOS - Biological and Flow Cytometry data collected from CTD stations in...
Flow cytometry data was collected in December 2018, in waters off South Australia. The general purpose of the study is to be able to establish background knowledge on the... -
Marine protected areas and dugong conservation along Australia's Indian ocean coast
The coastal zone of the Indian Ocean is coming under increasing pressure from human activities. Australia may be one of the few countries in this region that can afford to take... -
Irwin Inlet (WA) Seagrass 2009
This data is part of the 2013 report "Synthesis of seagrass mapping studies" conducted by the Water Science Branch of the Department of Water. Surveys were conducted by the WA... -
An Investigation of Benthic Sediment Characteristics in the Vicinity of the...
An Investigation of Benthic Sediment Characteristics in the Vicinity of the Cossack Pioneer FPSO, North West Shelf. -
Crown-of-thorns starfish (Acanthaster planci) feeding behaviour and...
Data on the feeding behaviour of Crown-of-Thorns Starfish (COTS) Acanthaster planci from two projects - P. Moran (1982-1987) and J. Keesing (1990). The data records the... -
Survey of soft sediment assemblages around Casey Station (Winter grab...
Marine soft-sediment assemblages were sampled from shallow (5 - 35m) nearshore regions around Casey Station, Windmill Islands, East Antarctica in winter 1998, using a van-Veen... -
Krill Fatty Acid Data
The fatty acid content and composition of the Antarctic krill Euphausia superba Dana, 1850 were investigated using samples collected by a commercial fishing vessel. This dataset... -
Quality control toolbox for EM-APEX data (Electromagnetic Autonomous...
The EM-APEX quality control (QC) toolbox provides a framework to quality control CTD and velocity data and calibrate velocity data collected from Electromagnetic Autonomous... -
Spatial distribution and morphology of the Halimeda bioherms of the Great...
Sediment derived from the decomposition of Halimeda algae is a major contributor to the tropical back-reef carbonate depositions. Halimeda bioherms occur extensively on the... -
antFOCE Hard Substrate Fauna data sets
Metadata record AAS_4127_antFOCE_HardSubstrateFauna contains all data sets relating to the fauna sampled from hard substrates during the antFOCE experiment, including... -
Aurora Australis Voyage 1 (THIRST) 1993-94 Demersal Fish Data
This dataset contains the data from Voyage 1 1993-94 of the Aurora Australis. The observations were taken from around Heard Island between August and September 1993. The data...