From Australian Oceans Data Network
JSON format icon JSON RDF format icon RDF ISO19115-3 XML

Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

Created 24/06/2025

Updated 24/06/2025

JSON format icon JSON RDF format icon RDF ISO19115-3 XML

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).

Files and APIs

Tags

Additional Info

Field Value
Title Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
Language eng
Licence Not Specified
Landing Page https://data.gov.au/data/en/dataset/5111dd74-d3cc-4f70-af67-d21c2abeccd7
Contact Point
Australian Ocean Data Network
metadata@aad.gov.au
Reference Period 16/11/2019 - 26/11/2019
Geospatial Coverage
Map data © OpenStreetMap contributors
{
  "coordinates": [
    [
      [
        77.2145,
        -68.0036
      ],
      [
        147.4927,
        -68.0036
      ],
      [
        147.4927,
        -43.2379
      ],
      [
        77.2145,
        -43.2379
      ],
      [
        77.2145,
        -68.0036
      ]
    ]
  ],
  "type": "Polygon"
}
Data Portal Australian Oceans Data Network

Data Source

This dataset was originally found on Australian Oceans Data Network "Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples". Please visit the source to access the original metadata of the dataset:
https://catalogue.aodn.org.au/geonetwork/srv/eng/csw/dataset/raw-sequencing-data-of-a-euphausiid-specific-metabarcoding-marker-to-detect-krill-species-of-th